pBbA5k-AcrB/AcrD/AcrFa, ABO_0964
(Plasmid
#86202)
-
PurposeExpresses efflux pump in E. coli to provide resistance to biofuel (medium copy)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86202 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBbA5k
- Backbone size w/o insert (bp) 5088
- Total vector size (bp) 9582
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEfflux pump
-
Insert Size (bp)3126
- Promoter ATCGTTTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAAT
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGATCCAAACTCGAGTAAGG
- 3′ sequencing primer GATCTTTTAAGAAGGAGATATACAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBbA5k-AcrB/AcrD/AcrFa, ABO_0964 was a gift from Mary Dunlop (Addgene plasmid # 86202 ; http://n2t.net/addgene:86202 ; RRID:Addgene_86202) -
For your References section:
Trade-Offs in Improving Biofuel Tolerance Using Combinations of Efflux Pumps. Turner WJ, Dunlop MJ. ACS Synth Biol. 2015 Oct 16;4(10):1056-63. doi: 10.1021/sb500307w. Epub 2014 Dec 12. 10.1021/sb500307w PubMed 25496359