pET28a(+)/FbGH30
(Plasmid
#86463)
-
PurposeExpression of the Beta-1,6-Exo-Laminarinase FbGH30 in E.coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86463 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28a(+)
-
Backbone manufacturerEMD Millipore
- Backbone size w/o insert (bp) 5369
- Total vector size (bp) 6812
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFbGH30
-
SpeciesFormosa B
-
Insert Size (bp)1443
-
GenBank IDAOR29490.1
- Promoter T7
-
Tag
/ Fusion Protein
- His-Tag (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCACAGCATGTACATCTAAAG
- 3′ sequencing primer TTAGTTTGGTAATACAATCGTTTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a(+)/FbGH30 was a gift from Jan-Hendrik Hehemann (Addgene plasmid # 86463 ; http://n2t.net/addgene:86463 ; RRID:Addgene_86463) -
For your References section:
Accurate quantification of laminarin in marine organic matter with enzymes from marine microbes. Becker S, Scheffel A, Polz MF, Hehemann JH. Appl Environ Microbiol. 2017 Feb 17. pii: AEM.03389-16. doi: 10.1128/AEM.03389-16. 10.1128/AEM.03389-16 PubMed 28213541