Skip to main content
Addgene

pMSCV-ArchT-GFP
(Plasmid #86536)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86536 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMSCV
  • Backbone size w/o insert (bp) 6910
  • Total vector size (bp) 7657
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ArchT
  • Alt name
    archaerhodopsin TP009
  • Species
    Synthetic; H. strain TP009
  • Insert Size (bp)
    747
  • GenBank ID
    HM367071.1
  • Promoter Synapsin I (human)
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer TGTGGCTGGGAATCGGAACC
  • 3′ sequencing primer AACCAGTGGGGGTTGCGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV-ArchT-GFP was a gift from Xue Han (Addgene plasmid # 86536 ; http://n2t.net/addgene:86536 ; RRID:Addgene_86536)
  • For your References section:

    Young adult born neurons enhance hippocampal dependent performance via influences on bilateral networks. Zhuo JM, Tseng HA, Desai M, Bucklin ME, Mohammed AI, Robinson NT, Boyden ES, Rangel LM, Jasanoff AP, Gritton HJ, Han X. Elife. 2016 Dec 3;5. pii: e22429. doi: 10.7554/eLife.22429. 10.7554/eLife.22429 PubMed 27914197