pMSCV-ArchT-GFP
(Plasmid
#86536)
-
PurposeRetrovirus expressing optogenetic silencer ArchT-GFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86536 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMSCV
- Backbone size w/o insert (bp) 6910
- Total vector size (bp) 7657
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameArchT
-
Alt namearchaerhodopsin TP009
-
SpeciesSynthetic; H. strain TP009
-
Insert Size (bp)747
-
GenBank IDHM367071.1
- Promoter Synapsin I (human)
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer TGTGGCTGGGAATCGGAACC
- 3′ sequencing primer AACCAGTGGGGGTTGCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-ArchT-GFP was a gift from Xue Han (Addgene plasmid # 86536 ; http://n2t.net/addgene:86536 ; RRID:Addgene_86536) -
For your References section:
Young adult born neurons enhance hippocampal dependent performance via influences on bilateral networks. Zhuo JM, Tseng HA, Desai M, Bucklin ME, Mohammed AI, Robinson NT, Boyden ES, Rangel LM, Jasanoff AP, Gritton HJ, Han X. Elife. 2016 Dec 3;5. pii: e22429. doi: 10.7554/eLife.22429. 10.7554/eLife.22429 PubMed 27914197