Skip to main content

ATP1A1_plasmid_donor_RD
(Plasmid #86551)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86551 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Total vector size (bp) 3217
  • Vector type
    Mammalian Expression, CRISPR, TALEN ; Co-selection via HDR using ouabain
  • Selectable markers
    Ouabain

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATP1A1
  • Alt name
    ATPase Na+/K+ transporting subunit alpha 1
  • Alt name
    Gene ID: 476
  • Species
    H. sapiens (human)
  • Mutation
    Q118R, N129D
  • GenBank ID
    476
  • Entrez Gene
    ATP1A1 (a.k.a. CMT2DD, HOMGSMR2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Acc65I (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer cagggttattgtctcatgagcgg
  • 3′ sequencing primer tgagcgaggaagcggaagag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ATP1A1_plasmid_donor_RD was a gift from Yannick Doyon (Addgene plasmid # 86551 ; http://n2t.net/addgene:86551 ; RRID:Addgene_86551)
  • For your References section:

    Marker-free coselection for CRISPR-driven genome editing in human cells. Agudelo D, Duringer A, Bozoyan L, Huard CC, Carter S, Loehr J, Synodinou D, Drouin M, Salsman J, Dellaire G, Laganiere J, Doyon Y. Nat Methods. 2017 Apr 17. doi: 10.1038/nmeth.4265. 10.1038/nmeth.4265 PubMed 28417998