MBP-TEV-VMA Model vector
(Plasmid
#86590)
-
PurposeThis can be used to make MBP-TEV-Cterm with SapI and PstI; and can also make N-term-VMA with NdeI and SapI
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86590 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepMAL-c5X
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameVMA intein
-
SpeciesS. cerevisiae (budding yeast)
-
MutationOriginal SapI site from pMal was mutated out
- Promoter Tac
-
Tag
/ Fusion Protein
- His6-MBP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer MBP-F
- 3′ sequencing primer TGTCCTACTCAGGAGAGCGTTCAC, ACCCATGACCTTATTACCAACCTC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
TGTCCTACTCAGGAGAGCGTTCAC to sequence VMA C-term; and ACCCATGACCTTATTACCAACCTC to sequence the insert between MBP C-term and VMA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MBP-TEV-VMA Model vector was a gift from Sharon Rozovsky (Addgene plasmid # 86590 ; http://n2t.net/addgene:86590 ; RRID:Addgene_86590) -
For your References section:
Utilizing Selenocysteine for Expressed Protein Ligation and Bioconjugations. Liu J, Chen Q, Rozovsky S. J Am Chem Soc. 2017 Feb 10. doi: 10.1021/jacs.6b10991. 10.1021/jacs.6b10991 PubMed 28186733