pY036_ATP1A1_G5_Array
(Plasmid
#86620)
-
PurposeVector for expression of a CRISPR/AsCpf1 array containing the ATP1A1 G5 guide in combination with a user-specified guide. Cloning of oligos for the second guide using BbsI sites. PY036-like plasmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86620 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepY036-U6-crRNA(BbsI)-CBh-AsCpf1
- Total vector size (bp) 8507
-
Vector typeMammalian Expression, CRISPR ; Co-selection via HDR using ouabain
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameATP1A1 G5 crRNA + user-specified crRNA + AsCpf1-3xHA
-
Alt namehAsCpf1
-
Alt nameCpf1
-
SpeciesAcidaminococcus_sp_BV3L6
-
Insert Size (bp)8507
- Promoter CBh
-
Tag
/ Fusion Protein
- 3xHA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer agggatggttggttggtggg
- 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pY036_ATP1A1_G5_Array was a gift from Yannick Doyon (Addgene plasmid # 86620 ; http://n2t.net/addgene:86620 ; RRID:Addgene_86620) -
For your References section:
Marker-free coselection for CRISPR-driven genome editing in human cells. Agudelo D, Duringer A, Bozoyan L, Huard CC, Carter S, Loehr J, Synodinou D, Drouin M, Salsman J, Dellaire G, Laganiere J, Doyon Y. Nat Methods. 2017 Apr 17. doi: 10.1038/nmeth.4265. 10.1038/nmeth.4265 PubMed 28417998