alpha7-nAChR(scramble control)
(Plasmid
#86649)
-
Purposeexpression of control shRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86649 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSuper
-
Vector typeMammalian Expression, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCHRNA7 (control)
-
gRNA/shRNA sequenceGCTCCTCATATATCATCAATA
-
SpeciesH. sapiens (human)
- Promoter H1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T7 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
alpha7-nAChR(scramble control) was a gift from Jaime Modiano (Addgene plasmid # 86649 ; http://n2t.net/addgene:86649 ; RRID:Addgene_86649) -
For your References section:
Nicotine-mediated signals modulate cell death and survival of T lymphocytes. Oloris SC, Frazer-Abel AA, Jubala CM, Fosmire SP, Helm KM, Robinson SR, Korpela DM, Duckett MM, Baksh S, Modiano JF. Toxicol Appl Pharmacol. 2010 Feb 1;242(3):299-309. doi: 10.1016/j.taap.2009.10.020. Epub 2009 Nov 4. 10.1016/j.taap.2009.10.020 PubMed 19896492