Skip to main content

beta4-nAChR (DPM negative control)
(Plasmid #86651)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86651 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSuper
  • Vector type
    Mammalian Expression, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CHRNB4 (control)
  • gRNA/shRNA sequence
    TCTCTGGGTGAAACAGGAAT
  • Species
    H. sapiens (human)
  • Promoter H1

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    beta4-nAChR (DPM negative control) was a gift from Jaime Modiano (Addgene plasmid # 86651 ; http://n2t.net/addgene:86651 ; RRID:Addgene_86651)
  • For your References section:

    Nicotine-mediated signals modulate cell death and survival of T lymphocytes. Oloris SC, Frazer-Abel AA, Jubala CM, Fosmire SP, Helm KM, Robinson SR, Korpela DM, Duckett MM, Baksh S, Modiano JF. Toxicol Appl Pharmacol. 2010 Feb 1;242(3):299-309. doi: 10.1016/j.taap.2009.10.020. Epub 2009 Nov 4. 10.1016/j.taap.2009.10.020 PubMed 19896492