alpha3-nAChR shRNA (Alpha-3.29)
(Plasmid
#86655)
-
Purposeexpression of shRNA targeting CHRNA3
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86655 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSuper
-
Vector typeMammalian Expression, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCHRNA3 (alpha3-nAChR)
-
gRNA/shRNA sequenceAAGTGTCAAGTATATTGCTGA
-
SpeciesH. sapiens (human)
-
Entrez GeneCHRNA3 (a.k.a. BAIPRCK, LNCR2, NACHRA3, PAOD2)
- Promoter H1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T7 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene NGS found that the "A" nucleotide at position 19 within the shRNA sequence is missing; depositing lab feels that functionality is likely maintained
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
alpha3-nAChR shRNA (Alpha-3.29) was a gift from Jaime Modiano (Addgene plasmid # 86655 ; http://n2t.net/addgene:86655 ; RRID:Addgene_86655)