pET tdTomato LIC cloning vector (u-tdTomato)
(Plasmid
#86926)
-
Purpose(Empty Backbone) pET LIC cloning vector for yORF-tdTomato
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86926 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET
- Backbone size (bp) 6192
-
Modifications to backbonetdTomato is from AddGene plasmid 62726.
-
Vector typeBacterial Expression
- Promoter T7
-
Tag
/ Fusion Protein
- tdTomato (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer T7 Forward
- 3′ sequencing primer T7 Reverse (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe sequence for tdTomato came from Addgene #62726 (pAAV-Syn-Chronos-tdTomato).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This plasmid can be used as a single-expression vector, and it is also compatible with our 2-series polycistronic destination vectors (2D, 2E, and 2Z), if co-expression with other genes is desired.
To clone into this vector, add LIC tags to the 5' end of your PCR primers.
Forward - 5' TTTAAGAAGGAGATATAGATC3'
Reverse - 5' GTTGGAGGATGAGAGGATCCC 3'
You MUST include a start ATG in your ORF. Do NOT include a stop codon with your reverse primer.
Linearize the plasmid with EcoRV, then gel purify.
When digesting the DNA with T4 polymerase, use dGTP for the insert and dCTP for your linearized vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET tdTomato LIC cloning vector (u-tdTomato) was a gift from Chris Jeans (Addgene plasmid # 86926 ; http://n2t.net/addgene:86926 ; RRID:Addgene_86926)