Skip to main content

pChuk
(Plasmid #87033)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87033 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    peGFP
  • Total vector size (bp) 6938
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IKKalpha
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Chuk (a.k.a. AI256658, Chuk1, Fbx24, Fbxo24, IKBKA, IKK alpha, IKK1, Ikka, NFKBIKA)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ATGGGCGGCCCCCGGGGCTGCGGC
  • 3′ sequencing primer TCATTCTGCTAACCAACTCCAATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pChuk was a gift from Georgios Stathopoulos (Addgene plasmid # 87033 ; http://n2t.net/addgene:87033 ; RRID:Addgene_87033)
  • For your References section:

    Myeloid-derived interleukin-1beta drives oncogenic KRAS-NF-kappaBeta addiction in malignant pleural effusion. Marazioti A, Lilis I, Vreka M, Apostolopoulou H, Kalogeropoulou A, Giopanou I, Giotopoulou GA, Krontira AC, Iliopoulou M, Kanellakis NI, Agalioti T, Giannou AD, Jones-Paris C, Iwakura Y, Kardamakis D, Blackwell TS, Taraviras S, Spella M, Stathopoulos GT. Nat Commun. 2018 Feb 14;9(1):672. doi: 10.1038/s41467-018-03051-z. 10.1038/s41467-018-03051-z PubMed 29445180