Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

plc242-GFP-Nprl2
(Plasmid #87051)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 87051 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    plc242
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Nprl2
  • Alt name
    NM_006545
  • Species
    H. sapiens (human)
  • Entrez Gene
    NPRL2 (a.k.a. FFEVF2, NPR2, NPR2L, TUSC4)
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GGCATGGACGAGCTGTACAAG
  • 3′ sequencing primer GCATTCATTTTATGTTTCAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    plc242-GFP-Nprl2 was a gift from David Sabatini (Addgene plasmid # 87051 ; http://n2t.net/addgene:87051 ; RRID:Addgene_87051)
  • For your References section:

    KICSTOR recruits GATOR1 to the lysosome and is necessary for nutrients to regulate mTORC1. Wolfson RL, Chantranupong L, Wyant GA, Gu X, Orozco JM, Shen K, Condon KJ, Petri S, Kedir J, Scaria SM, Abu-Remaileh M, Frankel WN, Sabatini DM. Nature. 2017 Feb 15. doi: 10.1038/nature21423. 10.1038/nature21423 PubMed 28199306