-
PurposeHTT HR arms with 18 CAG repeats and piggyBac selection cassette
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87228 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePBHR100A-1
-
Backbone manufacturerSBI System Biosciences
- Total vector size (bp) 12069
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name1.7kb HTT 5' homology arm, 2.5kb HTT 3' homology arm
-
SpeciesH. sapiens (human)
- Promoter EF1a driving selection cassette
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI/NotI (unknown if destroyed)
- 3′ cloning site BspQI (destroyed)/SpeI (unknown if destroyed)
- 5′ sequencing primer GTTTCGCCACCTCTGACTTG
- 3′ sequencing primer TCATTTTGACTCACGCGGTC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJOP-HTT-HR18Q was a gift from Mahmoud Pouladi (Addgene plasmid # 87228 ; http://n2t.net/addgene:87228 ; RRID:Addgene_87228) -
For your References section:
Reversal of Phenotypic Abnormalities by CRISPR/Cas9-Mediated Gene Correction in Huntington Disease Patient-Derived Induced Pluripotent Stem Cells. Xu X, Tay Y, Sim B, Yoon SI, Huang Y, Ooi J, Utami KH, Ziaei A, Ng B, Radulescu C, Low D, Ng AY, Loh M, Venkatesh B, Ginhoux F, Augustine GJ, Pouladi MA. Stem Cell Reports. 2017 Feb 21. pii: S2213-6711(17)30038-3. doi: 10.1016/j.stemcr.2017.01.022. 10.1016/j.stemcr.2017.01.022 PubMed 28238795