ACA8-YFPc
(Plasmid
#87243)
-
Purposefluorescence complementation assay
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87243 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAMPAT-35S
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameACA8
-
SpeciesA. thaliana (mustard weed)
-
Entrez GeneACA8 (a.k.a. AT5G57110, ''AUTOINHIBITED CA2+ -ATPASE, ''autoinhibited Ca2+ -ATPase, 'autoinhibited Ca2+ -ATPase, AT-ACA8, AUTOINHIBITED CA2+ -ATPASE, ISOFORM 8, ISOFORM 8'', MUL3.5, MUL3_5, autoinhibited Ca2+ -ATPase, isoform 8, isoform 8', isoform 8'')
- Promoter 35s
-
Tag
/ Fusion Protein
- YFPc (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ATGACGCACAATCCCACTATCCTTCGCA
- 3′ sequencing primer CATTTGGAGAAGGACCTCGAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ACA8-YFPc was a gift from Silke Robatzek (Addgene plasmid # 87243 ; http://n2t.net/addgene:87243 ; RRID:Addgene_87243) -
For your References section:
Plasma membrane calcium ATPases are important components of receptor-mediated signaling in plant immune responses and development. Frei dit Frey N, Mbengue M, Kwaaitaal M, Nitsch L, Altenbach D, Haweker H, Lozano-Duran R, Njo MF, Beeckman T, Huettel B, Borst JW, Panstruga R, Robatzek S. Plant Physiol. 2012 Jun;159(2):798-809. doi: 10.1104/pp.111.192575. Epub 2012 Apr 25. 10.1104/pp.111.192575 PubMed 22535420