pUC19-T7-Bottom-T
(Plasmid
#87310)
-
PurposeExpresses the "Bottom" transcript of the Split-Broccoli system under the control of the T7 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87310 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2686
- Total vector size (bp) 2865
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSplit-Broccoli system "Bottom" transcript
-
SpeciesSynthetic
-
Insert Size (bp)137
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer GCTATGACCATGATTACGCCAAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19-T7-Bottom-T was a gift from Donald Burke (Addgene plasmid # 87310 ; http://n2t.net/addgene:87310 ; RRID:Addgene_87310) -
For your References section:
A Fluorescent Split Aptamer for Visualizing RNA-RNA Assembly In Vivo. Alam KK, Tawiah KD, Lichte MF, Porciani D, Burke DH. ACS Synth Biol. 2017 May 26. doi: 10.1021/acssynbio.7b00059. 10.1021/acssynbio.7b00059 PubMed 28548488