pUC19-P70a-Top-T~Bottom-T
              
              
                (Plasmid
                
                #87315)
              
            
            
            
          - 
            PurposeControl plasmid. Encodes the Split-Broccoli system (Top + Bottom) with only "Top" under the control of E. coli sigma 70 promoter.
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87315 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepUC19
 - Backbone size w/o insert (bp) 2686
 - Total vector size (bp) 3018
 - 
              Vector typeBacterial Expression, Synthetic Biology
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameSplit-Broccoli system (promoter control)
 - 
                    SpeciesSynthetic
 - 
                  Insert Size (bp)590
 - Promoter P70a
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site NdeI (destroyed during cloning)
 - 3′ cloning site HindIII (destroyed during cloning)
 - 5′ sequencing primer GCGGCATCAGAGCAGATTGTACTG (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pUC19-P70a-Top-T~Bottom-T was a gift from Donald Burke (Addgene plasmid # 87315 ; http://n2t.net/addgene:87315 ; RRID:Addgene_87315) - 
                
For your References section:
A Fluorescent Split Aptamer for Visualizing RNA-RNA Assembly In Vivo. Alam KK, Tawiah KD, Lichte MF, Porciani D, Burke DH. ACS Synth Biol. 2017 May 26. doi: 10.1021/acssynbio.7b00059. 10.1021/acssynbio.7b00059 PubMed 28548488