pBabe-PI(WT)-Src(YF)-mCherry
(Plasmid #87357)

• Purpose: PI(WT): Photo-inhibitable/blue light sensitive; YF: Y535F const. active mutation
• Depositing Lab: Klaus Hahn
• Depositing Organization: University of North Carolina at Chapel Hill
  Located in United States of America
• Publication: Dagliyan et al Science. 2016 Dec 16;354(6318):1441-1444.

Backbone

• Vector backbone: pBABE
• Backbone size w/o insert (bp): 5371
• Total vector size (bp): 8131
• Modifications to backbone: different linker between C terminus of LOV and Src than the one in pBabe-PI(WT)-Src(WT)-mCherry
• Vector type: Mammalian Expression, Bacterial Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: LOV2
• Species: Synthetic
• Insert Size (bp): 447
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (N terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: aagtatcgggccctttgtgc
• 3′ sequencing primer: CACCTTCAGCTTGGCGGTCTG

Gene/Insert 2

• Gene/Insert name: Src isoform 2
• Alt name: Rous sarcoma oncogene
• Species: M. musculus (mouse)
• Insert Size (bp): 2031
• Mutation: Y535F
• GenBank ID: 20779 20779
• Entrez Gene: Src (a.k.a. pp60c-src)
• Promoter: CMV

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: AAGTTCTTTTGCCGCCTCATC
• 3′ sequencing primer: CACCTTCAGCTTGGCGGTCTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 87357-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 87357-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.