Skip to main content
Holiday Schedule: Addgene will be closed December 23 - January 2. Order processing and shipping will resume on January 3, 2023. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #87550)


Item Catalog # Description Quantity Price (USD)
Plasmid 87550 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5371
  • Total vector size (bp) 8131
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer GAGATCAAGCAGAGGCTGAAG
  • 3′ sequencing primer AAGTTCTTTTGCCGCCTCATC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Alt name
    ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
    5879 5879
  • Entrez Gene
    RAC1 (a.k.a. MIG5, MRD48, Rac-1, TC-25, p21-Rac1)
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer GAGATCAAGCAGAGGCTGAAG
  • 3′ sequencing primer AAGTTCTTTTGCCGCCTCATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBabe-PI(WT)-Rac1(WT)-mCherry was a gift from Klaus Hahn (Addgene plasmid # 87550 ; ; RRID:Addgene_87550)
  • For your References section:

    Engineering extrinsic disorder to control protein activity in living cells. Dagliyan O, Tarnawski M, Chu PH, Shirvanyants D, Schlichting I, Dokholyan NV, Hahn KM. Science. 2016 Dec 16;354(6318):1441-1444. 10.1126/science.aah3404 PubMed 27980211