Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #87363)


Item Catalog # Description Quantity Price (USD)
Plasmid 87363 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pBad His B
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 4076
  • Total vector size (bp) 5494
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
    Green-red vine Tomato
  • Species
  • Insert Size (bp)
  • Promoter AraBad
  • Tag / Fusion Protein
    • His-Tag (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATGGTATGGCTAGCATGACTGGT
  • 3′ sequencing primer ACTCAGGAGAGCGTTCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBad-HisB-GRvT was a gift from Robert Campbell (Addgene plasmid # 87363 ; ; RRID:Addgene_87363)
  • For your References section:

    A tandem green-red heterodimeric fluorescent protein with high FRET efficiency. Wiens M, Shen Y, Li X, Salem M, Smisdom N, Zhang W, Brown A, Campbell RE. Chembiochem. 2016 Oct 26. doi: 10.1002/cbic.201600492. 10.1002/cbic.201600492 PubMed 27781394