-
PurposeExpresses HF-BE3-NLS with an N-terminal His Tag (His6) for bacterial expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87438 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET_42b
- Backbone size w/o insert (bp) 4983
- Total vector size (bp) 10146
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHF-BE3
-
Alt nameGGS-His6-rAPOBEC1-XTEN-nHF-Cas9-GGS-UGI-GGS-NLS
-
SpeciesH. sapiens (human), R. norvegicus (rat); Bacillus phage PBS2
-
Insert Size (bp)5163
-
Entrez GeneApobec1 (a.k.a. REPR, apobec-1)
-
Tag
/ Fusion Protein
- His6 (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET42b-HF-BE3 was a gift from David Liu (Addgene plasmid # 87438 ; http://n2t.net/addgene:87438 ; RRID:Addgene_87438) -
For your References section:
Improving the DNA specificity and applicability of base editing through protein engineering and protein delivery. Rees HA, Komor AC, Yeh WH, Caetano-Lopes J, Warman M, Edge ASB, Liu DR. Nat Commun. 2017 Jun 6;8:15790. doi: 10.1038/ncomms15790. 10.1038/ncomms15790 PubMed 28585549