This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #87438)


Item Catalog # Description Quantity Price (USD)
Plasmid 87438 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4983
  • Total vector size (bp) 10146
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human), R. norvegicus (rat); Bacillus phage PBS2
  • Insert Size (bp)
  • Tag / Fusion Protein
    • His6 (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET42b-HF-BE3 was a gift from David Liu (Addgene plasmid # 87438)
  • For your References section:

    Improving the DNA specificity and applicability of base editing through protein engineering and protein delivery. Rees HA, Komor AC, Yeh WH, Caetano-Lopes J, Warman M, Edge ASB, Liu DR. Nat Commun. 2017 Jun 6;8:15790. doi: 10.1038/ncomms15790. 10.1038/ncomms15790 PubMed 28585549