pGBKT7-CLF1
(Plasmid
#87548)
-
PurposeEncodes Y2H Gal4 DNA binding domain for Clf1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87548 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGBKT7
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 7300
- Total vector size (bp) 9342
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCLF1
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2077
-
GenBank IDNP_013218.1
-
Entrez GeneCLF1 (a.k.a. YLR117C, NTC77, SYF3)
-
Tags
/ Fusion Proteins
- GAL4 BD (N terminal on backbone)
- Myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer cctgcatatggacactttagagccaac
- 3′ sequencing primer cctttgtccttgtccgtgaaactcctagg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGBKT7-CLF1 was a gift from Aaron Hoskins (Addgene plasmid # 87548 ; http://n2t.net/addgene:87548 ; RRID:Addgene_87548) -
For your References section:
SF3b1 mutations associated with myelodysplastic syndromes alter the fidelity of branchsite selection in yeast. Carrocci TJ, Zoerner DM, Paulson JC, Hoskins AA. Nucleic Acids Res. 2017 Jan 6. pii: gkw1349. doi: 10.1093/nar/gkw1349. 10.1093/nar/gkw1349 PubMed 28062854