Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCasY1
(Plasmid #87687)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 87687 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    p15A
  • Total vector size (bp) 6566
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CasY1
  • Species
    Groundwater metagenome
  • Insert Size (bp)
    3378
  • GenBank ID
    OJI08769.1 OJI08769.1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gtgccgatcaacgtAtcattttcg
  • 3′ sequencing primer acgcagaaaggcccacccgaag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCasY1 was a gift from Jennifer Doudna (Addgene plasmid # 87687 ; http://n2t.net/addgene:87687 ; RRID:Addgene_87687)
  • For your References section:

    New CRISPR-Cas systems from uncultivated microbes. Burstein D, Harrington LB, Strutt SC, Probst AJ, Anantharaman K, Thomas BC, Doudna JA, Banfield JF. Nature. 2016 Dec 22. doi: 10.1038/nature21059. 10.1038/nature21059 PubMed 28005056