Skip to main content

pHT-497
(Plasmid #87756)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87756 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pND1 with modified restriction sites
  • Backbone manufacturer
    see Biochim Biophy Acta. 1990; 1050(1–3): 18–26.
  • Backbone size w/o insert (bp) 2217
  • Total vector size (bp) 3733
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Gene coding for rat DYRK1A kinase domain (residues 1-497)
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1516
  • GenBank ID
    XM_008768565.2
  • Promoter T7 RNA polymerase promoter
  • Tag / Fusion Protein
    • 6X histidine tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Cla I (not destroyed)
  • 3′ cloning site Xho I (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGGA
  • 3′ sequencing primer AATTAACCCTCACTAAAGGGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Requires strains with T7 RNA polymerase (e.g. BL21) for expression

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHT-497 was a gift from Yu-Wen Hwang (Addgene plasmid # 87756 ; http://n2t.net/addgene:87756 ; RRID:Addgene_87756)