Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #87972)


Item Catalog # Description Quantity Price (USD)
Plasmid 87972 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Entrez Gene
    RAP2A (a.k.a. K-REV, KREV, RAP2, RbBP-30)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer TGTACGGTGGGAGGTCTATATAAG
  • 3′ sequencing primer CCTGGGGACGTCGTCGCGGGTGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLJC1-Rap2A-3xFLAG was a gift from David Sabatini (Addgene plasmid # 87972 ; ; RRID:Addgene_87972)
  • For your References section:

    Physiologic Medium Rewires Cellular Metabolism and Reveals Uric Acid as an Endogenous Inhibitor of UMP Synthase. Cantor JR, Abu-Remaileh M, Kanarek N, Freinkman E, Gao X, Louissaint A Jr, Lewis CA, Sabatini DM. Cell. 2017 Apr 6;169(2):258-272.e17. doi: 10.1016/j.cell.2017.03.023. 10.1016/j.cell.2017.03.023 PubMed 28388410