Skip to main content

pWN10042
(Plasmid #89052)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89052 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGGS
  • Backbone size w/o insert (bp) 4026
  • Total vector size (bp) 5994
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    EGFP part 1
  • Alt name
    enhanced green fluorescent protein part 1
  • Insert Size (bp)
    603
  • Promoter CAG

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer CAACGTGCTGGTTATTGTGC
  • 3′ sequencing primer CCTCTGACTTGAGCGTCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    EGFP part 2
  • Alt name
    enhanced green fluorescent protein part 2
  • Insert Size (bp)
    599
  • Promoter none

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer gctgaagccagttacct
  • 3′ sequencing primer TCAGTGGTATTTGTGAGCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWN10042 was a gift from Ervin Welker (Addgene plasmid # 89052 ; http://n2t.net/addgene:89052 ; RRID:Addgene_89052)
  • For your References section:

    Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Toth E, Weinhardt N, Bencsura P, Huszar K, Kulcsar PI, Talas A, Fodor E, Welker E. Biol Direct. 2016 Sep 14;11:46. doi: 10.1186/s13062-016-0147-0. 10.1186/s13062-016-0147-0 [pii] PubMed 27630115