pWN10042
(Plasmid
#89052)
-
PurposeGF-ori-FP plasmid for GFxFP assay
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89052 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 4026
- Total vector size (bp) 5994
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameEGFP part 1
-
Alt nameenhanced green fluorescent protein part 1
-
Insert Size (bp)603
- Promoter CAG
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CAACGTGCTGGTTATTGTGC
- 3′ sequencing primer CCTCTGACTTGAGCGTCG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEGFP part 2
-
Alt nameenhanced green fluorescent protein part 2
-
Insert Size (bp)599
- Promoter none
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer gctgaagccagttacct
- 3′ sequencing primer TCAGTGGTATTTGTGAGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWN10042 was a gift from Ervin Welker (Addgene plasmid # 89052 ; http://n2t.net/addgene:89052 ; RRID:Addgene_89052) -
For your References section:
Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Toth E, Weinhardt N, Bencsura P, Huszar K, Kulcsar PI, Talas A, Fodor E, Welker E. Biol Direct. 2016 Sep 14;11:46. doi: 10.1186/s13062-016-0147-0. 10.1186/s13062-016-0147-0 [pii] PubMed 27630115