Skip to main content

pFS478
(Plasmid #89066)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89066 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFS6a-KanMX6-P3nmt1
  • Backbone manufacturer
    Bahler et al, Yeast, 14(10) 943-51, 1998
  • Backbone size w/o insert (bp) 5100
  • Total vector size (bp) 4654
  • Modifications to backbone
    replaced nmt1 promoter in backbone with Z3EV promoter
  • Vector type
    Yeast integration vector
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Z3EV promoter cassette
  • Species
    Synthetic
  • Insert Size (bp)
    699
  • Mutation
    yeast Gal1 promoter modified with multiple Zif268 binding sites
  • Promoter Z3EV promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer acagatctcgccataaa
  • 3′ sequencing primer ttaaagacatgatttaacaa
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    McIsaac, R.S. et al., 2011. Fast-acting and nearly gratuitous induction of gene expression and protein depletion in Saccharomyces cerevisiae. Molecular biology of the cell, 22(22), pp.4447–59. McIsaac, R.S. et al., 2014. Synthetic biology tools for programming gene expression without nutritional perturbations in Saccharomyces cerevisiae. Nucleic Acids Research, 42(6), pp.1–8.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFS478 was a gift from Nick Rhind (Addgene plasmid # 89066 ; http://n2t.net/addgene:89066 ; RRID:Addgene_89066)
  • For your References section:

    An estradiol-inducible promoter enables fast, graduated control of gene expression in fission yeast. Ohira MJ, Hendrickson DG, Scott McIsaac R, Rhind N. Yeast. 2017 Aug;34(8):323-334. doi: 10.1002/yea.3235. Epub 2017 Jun 8. 10.1002/yea.3235 PubMed 28423198