pAc5.1-S1-GFP-FM4-FCS-hGH
(Plasmid
#89314)
-
PurposeExpresses GFP tagged secretory reporter in Drosophila cells
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89314 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAC5/V5-HIS
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 8100
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameS1-GFP-FM4-GH
-
Alt nameGFP tagged secretory reporter
-
SpeciesSynthetic
-
Insert Size (bp)2709
- Promoter P-AC5 (Actin 5C)
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ACACAAAGCCGCTCCATCAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAc5.1-S1-GFP-FM4-FCS-hGH was a gift from Andrew Peden (Addgene plasmid # 89314)