pFS485
(Plasmid
#89348)
-
PurposeLeu1 integrating plasmid with cdc25 genomic fragment
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89348 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJK148
-
Backbone manufacturerKeeney and Boeke, Genetics, 136:849 (1994)
- Total vector size (bp) 10048
-
Modifications to backbonecdc25 genomic fragment cloned into pJK148 with KpnI and SacI
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecdc25
-
SpeciesS. pombe (fission yeast)
-
Insert Size (bp)2804
-
Entrez Genecdc25 (a.k.a. SPAC24H6.05, sal2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer TGTAAAACGACGGCCAGT
- 3′ sequencing primer CATGGTCATAGCTGTTTCCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFS485 was a gift from Nick Rhind (Addgene plasmid # 89348 ; http://n2t.net/addgene:89348 ; RRID:Addgene_89348) -
For your References section:
Size-Dependent Expression of the Mitotic Activator Cdc25 Suggests a Mechanism of Size Control in Fission Yeast. Keifenheim D, Sun XM, D'Souza E, Ohira MJ, Magner M, Mayhew MB, Marguerat S, Rhind N. Curr Biol. 2017 May 22;27(10):1491-1497.e4. doi: 10.1016/j.cub.2017.04.016. Epub 2017 May 4. 10.1016/j.cub.2017.04.016 PubMed 28479325