Skip to main content

pFS485
(Plasmid #89348)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89348 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJK148
  • Backbone manufacturer
    Keeney and Boeke, Genetics, 136:849 (1994)
  • Total vector size (bp) 10048
  • Modifications to backbone
    cdc25 genomic fragment cloned into pJK148 with KpnI and SacI
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cdc25
  • Species
    S. pombe (fission yeast)
  • Insert Size (bp)
    2804
  • Entrez Gene
    cdc25 (a.k.a. SPAC24H6.05, sal2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer TGTAAAACGACGGCCAGT
  • 3′ sequencing primer CATGGTCATAGCTGTTTCCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFS485 was a gift from Nick Rhind (Addgene plasmid # 89348 ; http://n2t.net/addgene:89348 ; RRID:Addgene_89348)
  • For your References section:

    Size-Dependent Expression of the Mitotic Activator Cdc25 Suggests a Mechanism of Size Control in Fission Yeast. Keifenheim D, Sun XM, D'Souza E, Ohira MJ, Magner M, Mayhew MB, Marguerat S, Rhind N. Curr Biol. 2017 May 22;27(10):1491-1497.e4. doi: 10.1016/j.cub.2017.04.016. Epub 2017 May 4. 10.1016/j.cub.2017.04.016 PubMed 28479325