pFS345
(Plasmid
#89349)
-
PurposeBeetle Luciferase C-term tagging vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89349 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFA6a-KanMX6
-
Backbone manufacturerhttps://www.addgene.org/39292/
- Backbone size w/o insert (bp) 4882
- Total vector size (bp) 5818
-
Vector typeC-terminal tagging vector
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBeetle luciferase
-
SpeciesPhotinus pyralis
-
Insert Size (bp)3086
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer GCATTAATTAACGAAGACGCCAAAAACATAAAGA
- 3′ sequencing primer GCAGGCGCGCCCTACACGGCGATCTTTCCGCCCTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFS345 was a gift from Nick Rhind (Addgene plasmid # 89349 ; http://n2t.net/addgene:89349 ; RRID:Addgene_89349) -
For your References section:
Size-Dependent Expression of the Mitotic Activator Cdc25 Suggests a Mechanism of Size Control in Fission Yeast. Keifenheim D, Sun XM, D'Souza E, Ohira MJ, Magner M, Mayhew MB, Marguerat S, Rhind N. Curr Biol. 2017 May 22;27(10):1491-1497.e4. doi: 10.1016/j.cub.2017.04.016. Epub 2017 May 4. 10.1016/j.cub.2017.04.016 PubMed 28479325