-
PurposeExpresses EGFP-GS1 (Human Gelsolin 53-176) in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89445 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4746
- Total vector size (bp) 5118
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDeAct-GS1
-
Alt nameGelsolin segment 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)372
-
MutationTruncation spanning cytoplasmic Gsn amino acids 53-176
-
GenBank IDNM_000177.4
-
Entrez GeneGSN (a.k.a. ADF, AGEL)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer ATGTGGTATGGCTGATTATG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-DeAct-GS1 was a gift from Brad Zuchero (Addgene plasmid # 89445 ; http://n2t.net/addgene:89445 ; RRID:Addgene_89445) -
For your References section:
DeActs: genetically encoded tools for perturbing the actin cytoskeleton in single cells. Harterink M, da Silva ME, Will L, Turan J, Ibrahim A, Lang AE, van Battum EY, Pasterkamp RJ, Kapitein LC, Kudryashov D, Barres BA, Hoogenraad CC, Zuchero JB. Nat Methods. 2017 Apr 10. doi: 10.1038/nmeth.4257. 10.1038/nmeth.4257 PubMed 28394337