Skip to main content

pCMV-DeAct-SpvB
(Plasmid #89446)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89446 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4746
  • Total vector size (bp) 5394
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DeAct-SpvB
  • Alt name
    Salmonella SpvB(375-591)
  • Species
    Salmonella enterica
  • Insert Size (bp)
    648
  • Mutation
    Truncation spanning SpvB amino acids 375-591 (mono(ADP-ribosyl)transferase domain)
  • GenBank ID
    D14490.1
  • Entrez Gene
    spvB (a.k.a. pOU1113_03)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer ATGTGGTATGGCTGATTATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-DeAct-SpvB was a gift from Brad Zuchero (Addgene plasmid # 89446 ; http://n2t.net/addgene:89446 ; RRID:Addgene_89446)
  • For your References section:

    DeActs: genetically encoded tools for perturbing the actin cytoskeleton in single cells. Harterink M, da Silva ME, Will L, Turan J, Ibrahim A, Lang AE, van Battum EY, Pasterkamp RJ, Kapitein LC, Kudryashov D, Barres BA, Hoogenraad CC, Zuchero JB. Nat Methods. 2017 Apr 10. doi: 10.1038/nmeth.4257. 10.1038/nmeth.4257 PubMed 28394337