Tet-pLKO-FOXM1-shRNA-81
(Plasmid
#89497)
-
PurposeLentiviral vector with dox inducible expression of shRNA targeting human FOXM1.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89497 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneTet-pLKO-puro
- Backbone size w/o insert (bp) 10633
- Total vector size (bp) 8816
-
Vector typeMammalian Expression, Lentiviral, RNAi ; Doxycycline inducible
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFOXM1
-
gRNA/shRNA sequenceAGGACCACTTTCCCTACTTTA
-
SpeciesH. sapiens (human)
-
Entrez GeneFOXM1 (a.k.a. FKHL16, FOXM1A, FOXM1B, FOXM1C, HFH-11, HFH11, HNF-3, INS-1, MPHOSPH2, MPP-2, MPP2, PIG29, TRIDENT)
- Promoter H1/TO
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The FOXM1 shRNA (TRCN0000273981) sequence was retrieved from the Broad Genetic Perturbation Platform Web Portal. Oligos corresponding to the shRNA were annealed and ligated into Tet-pLKO-puro.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tet-pLKO-FOXM1-shRNA-81 was a gift from Adam Karpf (Addgene plasmid # 89497 ; http://n2t.net/addgene:89497 ; RRID:Addgene_89497)