-
PurposeExpress csgA curli protein with GS linker and Histaq
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89581 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET-22b(+)
- Backbone size w/o insert (bp) 5405
- Total vector size (bp) 5927
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecsgA
-
Alt namemajor curli subunit
-
Insert Size (bp)552
-
Entrez GenecsgA (a.k.a. b1042, ECK1028)
-
Tags
/ Fusion Proteins
- 3xGGSG linker - TEV site - 3xGGSG linker (C terminal on insert)
- 6xHis tag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET22b-csgA was a gift from Urartu Seker (Addgene plasmid # 89581 ; http://n2t.net/addgene:89581 ; RRID:Addgene_89581) -
For your References section:
Genetically-Tunable Mechanical Properties of Bacterial Functional Amyloid Nanofibers. Abdelwahab MT, Kalyoncu E, Onur T, Baykara MZ, Seker UO. Langmuir. 2017 Apr 7. doi: 10.1021/acs.langmuir.7b00112. 10.1021/acs.langmuir.7b00112 PubMed 28388843