pSB1A3_GFP_dT21
              
              
                (Plasmid
                
                #89662)
              
            
            
            
          - 
            Purposeexpression of doubleTAL staple protein dT21 with N-terminally fused cycle3-GFP
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89662 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepSB1A3
 - 
              Backbone manufacturerigem parts registry
 - 
              Vector typeBacterial Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert nameGFP_dT21
 - 
                    SpeciesSynthetic
 - 
                  Insert Size (bp)6000
 - Promoter T7
 - 
    
        Tag
        / Fusion Protein
    
- His6 (C terminal on insert)
 
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site unknown (unknown if destroyed)
 - 3′ cloning site unknown (unknown if destroyed)
 - 5′ sequencing primer attaccgcctttgagtgagc
 - 3′ sequencing primer tgccacctgacgtctaagaa (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pSB1A3_GFP_dT21 was a gift from Hendrik Dietz (Addgene plasmid # 89662 ; http://n2t.net/addgene:89662 ; RRID:Addgene_89662) - 
                
For your References section:
Self-assembly of genetically encoded DNA-protein hybrid nanoscale shapes. Praetorius F, Dietz H. Science. 2017 Mar 24;355(6331). pii: eaam5488. doi: 10.1126/science.aam5488. 10.1126/science.aam5488 PubMed 28336611