pexK4_bow_360
(Plasmid
#89673)
-
PurposePlasmid for the construction of DNA-protein hybrid nanostructures. Template for the bent two-helix-bundle shown in figure 3B of associated article.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89673 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEX-K4
-
Backbone manufacturerEurofins
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namebow_360
-
SpeciesSynthetic
-
Insert Size (bp)1051
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer ggagcagacaagcccgtcagg
- 3′ sequencing primer caggctttacactttatgcttccggc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pexK4_bow_360 was a gift from Hendrik Dietz (Addgene plasmid # 89673 ; http://n2t.net/addgene:89673 ; RRID:Addgene_89673) -
For your References section:
Self-assembly of genetically encoded DNA-protein hybrid nanoscale shapes. Praetorius F, Dietz H. Science. 2017 Mar 24;355(6331). pii: eaam5488. doi: 10.1126/science.aam5488. 10.1126/science.aam5488 PubMed 28336611