pAAV-IRES-hrGFP-mWnt3a
(Plasmid
#89771)
-
PurposeExpresses mouse Wnt3a in mammalian cells
-
Depositing Lab
-
Depositing OrganizationStony Brook University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89771 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-IRES-hrGFP
-
Backbone manufacturerAgilent Technologies
- Backbone size w/o insert (bp) 6100
- Total vector size (bp) 7160
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemouse Wnt3a
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1060
-
Entrez GeneWnt3a (a.k.a. Wnt-3a, vt)
- Promoter CMV
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ATTCTGAGTCCAAGCTAGGC (beta-globin)
- 3′ sequencing primer TAGAAGGACACCTAGTCAGA (hGH polyA)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-IRES-hrGFP-mWnt3a was a gift from Ken-Ichi Takemaru (Addgene plasmid # 89771 ; http://n2t.net/addgene:89771 ; RRID:Addgene_89771) -
For your References section:
Abrogation of beta-catenin signaling in oligodendrocyte precursor cells reduces glial scarring and promotes axon regeneration after CNS injury. Rodriguez JP, Coulter M, Miotke J, Meyer RL, Takemaru K, Levine JM. J Neurosci. 2014 Jul 30;34(31):10285-97. doi: 10.1523/JNEUROSCI.4915-13.2014. 10.1523/JNEUROSCI.4915-13.2014 PubMed 25080590