Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-IRES-hrGFP-mWnt3a
(Plasmid #89771)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89771 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-IRES-hrGFP
  • Backbone manufacturer
    Agilent Technologies
  • Backbone size w/o insert (bp) 6100
  • Total vector size (bp) 7160
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mouse Wnt3a
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1060
  • Entrez Gene
    Wnt3a (a.k.a. Wnt-3a, vt)
  • Promoter CMV
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer ATTCTGAGTCCAAGCTAGGC (beta-globin)
  • 3′ sequencing primer TAGAAGGACACCTAGTCAGA (hGH polyA)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-IRES-hrGFP-mWnt3a was a gift from Ken-Ichi Takemaru (Addgene plasmid # 89771 ; http://n2t.net/addgene:89771 ; RRID:Addgene_89771)
  • For your References section:

    Abrogation of beta-catenin signaling in oligodendrocyte precursor cells reduces glial scarring and promotes axon regeneration after CNS injury. Rodriguez JP, Coulter M, Miotke J, Meyer RL, Takemaru K, Levine JM. J Neurosci. 2014 Jul 30;34(31):10285-97. doi: 10.1523/JNEUROSCI.4915-13.2014. 10.1523/JNEUROSCI.4915-13.2014 PubMed 25080590