Skip to main content

pBSU6-shTOM40.3
(Plasmid #89796)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89796 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBSU6
  • Backbone size w/o insert (bp) 3292
  • Total vector size (bp) 3304
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRNA Tom40
  • gRNA/shRNA sequence
    GGCACTGTCATGTCTCTAGCT
  • Species
    M. musculus (mouse)
  • Promoter U6
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ApaI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBSU6-shTOM40.3 was a gift from Robert Friedlander (Addgene plasmid # 89796 ; http://n2t.net/addgene:89796 ; RRID:Addgene_89796)
  • For your References section:

    Inhibition of mitochondrial protein import by mutant huntingtin. Yano H, Baranov SV, Baranova OV, Kim J, Pan Y, Yablonska S, Carlisle DL, Ferrante RJ, Kim AH, Friedlander RM. Nat Neurosci. 2014 Jun;17(6):822-31. doi: 10.1038/nn.3721. Epub 2014 May 18. 10.1038/nn.3721 PubMed 24836077
Commonly requested with: