Skip to main content

pGL3-Basic-Fascin-Promoter 402 mutation
(Plasmid #89825)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89825 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL3-Basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 4818
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Fascin1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    546
  • Mutation
    -370 Smad binding element mutated from CAGAC to TTAGT
  • GenBank ID
    NM_003088.3
  • Entrez Gene
    FSCN1 (a.k.a. FAN1, HSN, SNL, p55)
  • Promoter SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CC CTCGAG GTGCTCCAAGGCCACCTCC
  • 3′ sequencing primer GG AAGCTT ggtggcagtagacgagaggc
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-Basic-Fascin-Promoter 402 mutation was a gift from Shengyu Yang (Addgene plasmid # 89825 ; http://n2t.net/addgene:89825 ; RRID:Addgene_89825)
  • For your References section:

    GATA3 transcription factor abrogates Smad4 transcription factor-mediated fascin overexpression, invadopodium formation, and breast cancer cell invasion. Sun J, He H, Pillai S, Xiong Y, Challa S, Xu L, Chellappan S, Yang S. J Biol Chem. 2013 Dec 27;288(52):36971-82. doi: 10.1074/jbc.M113.506535. Epub 2013 Nov 14. 10.1074/jbc.M113.506535 PubMed 24235142