pLPCX2-HA-GATA3 N1(1-259)
(Plasmid
#89830)
-
PurposeExpress GATA3 N1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89830 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLNCX2
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6100
- Total vector size (bp) 6100
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGata3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)780
-
MutationN1 (AA 1-259)
-
GenBank IDNM_008091.3
-
Entrez GeneGata3 (a.k.a. Gata-3, jal)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AAA AGATCT ATG GAC TACCCTTATGATGTGCCGGATTATGCC gaggtgactgcggaccag
- 3′ sequencing primer GGCC GAATTC CTA attcattttatggtagagtccg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLPCX2-HA-GATA3 N1(1-259) was a gift from Shengyu Yang (Addgene plasmid # 89830 ; http://n2t.net/addgene:89830 ; RRID:Addgene_89830) -
For your References section:
GATA3 transcription factor abrogates Smad4 transcription factor-mediated fascin overexpression, invadopodium formation, and breast cancer cell invasion. Sun J, He H, Pillai S, Xiong Y, Challa S, Xu L, Chellappan S, Yang S. J Biol Chem. 2013 Dec 27;288(52):36971-82. doi: 10.1074/jbc.M113.506535. Epub 2013 Nov 14. 10.1074/jbc.M113.506535 PubMed 24235142