Skip to main content

pLPCX2-HA-GATA3 C1(259-443)
(Plasmid #89832)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89832 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLNCX2
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6100
  • Vector type
    Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Gata3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    540
  • Mutation
    C1 (AA 259-443)
  • GenBank ID
    NM_008091.3
  • Entrez Gene
    Gata3 (a.k.a. Gata-3, jal)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGCC AGATCT ATG GAC TACCCTTATGATGTGCCGGATTATGCC gaaggcagggagtgtgtgaactg
  • 3′ sequencing primer AAA GAATTC T acccatggcggtgaccatgctg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLPCX2-HA-GATA3 C1(259-443) was a gift from Shengyu Yang (Addgene plasmid # 89832 ; http://n2t.net/addgene:89832 ; RRID:Addgene_89832)
  • For your References section:

    GATA3 transcription factor abrogates Smad4 transcription factor-mediated fascin overexpression, invadopodium formation, and breast cancer cell invasion. Sun J, He H, Pillai S, Xiong Y, Challa S, Xu L, Chellappan S, Yang S. J Biol Chem. 2013 Dec 27;288(52):36971-82. doi: 10.1074/jbc.M113.506535. Epub 2013 Nov 14. 10.1074/jbc.M113.506535 PubMed 24235142