pGEM BirA-2A-Citrine-SV40pA-FRT-Kan-FRT
(Plasmid
#89890)
-
PurposeBAC donor construct containing 3XHA-tagged BirA, a ribosome skipping motif - 2A, Citrine reporter, polyadenyation signal, followed by FRT recombination sites flanking kanamycin selection cassette.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89890 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEM-GFP-SV40pA-FRT-Kan-FRT
- Backbone size w/o insert (bp) 4780
- Total vector size (bp) 6644
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHA-BirA-2A-citrine
-
SpeciesD. rerio (zebrafish), Synthetic
-
Insert Size (bp)1864
-
Tag
/ Fusion Protein
- Citrine (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacII (unknown if destroyed)
- 3′ cloning site BsrgI (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer ATTTAGGTGACACTATAGAA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypGEM-NLS-BirA-2A-mCherry-SV40pA-FKF (Plasmid #79889) - Sauka-Spengler lab plasmid
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEM BirA-2A-Citrine-SV40pA-FRT-Kan-FRT was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 89890 ; http://n2t.net/addgene:89890 ; RRID:Addgene_89890) -
For your References section:
Generation of a double binary transgenic zebrafish model to study myeloid gene regulation in response to oncogene activation in melanocytes. Kenyon A, Gavriouchkina D, Zorman J, Chong-Morrison V, Napolitani G, Cerundolo V, Sauka-Spengler T. Dis Model Mech. 2018 Apr 6;11(4). pii: dmm.030056. doi: 10.1242/dmm.030056. 10.1242/dmm.030056 PubMed 29666124