pBZCas13b-HEPN
(Plasmid
#89901)
-
PurposeBacterial expression for bzCas13b and crRNA with both HEPN domains mutated. New spacers can be cloned by digesting with BsaI.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89901 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACYC184
- Backbone size w/o insert (bp) 4245
- Total vector size (bp) 8098
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCas13b
-
SpeciesB. zoohelcum ATCC 43767
-
Insert Size (bp)3672
-
MutationR116A/H121A/R1177A/H1182A
- Promoter Lac
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atgccggtactgccgggcctcttgcgggat
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCloned from genomic DNA purchased from ATCC of B. zoohelcum ATCC 43767.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Benchling sequence link: https://benchling.com/s/seq-gyNy5vRceFfoBk3kqStl
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBZCas13b-HEPN was a gift from Feng Zhang (Addgene plasmid # 89901 ; http://n2t.net/addgene:89901 ; RRID:Addgene_89901) -
For your References section:
Cas13b Is a Type VI-B CRISPR-Associated RNA-Guided RNase Differentially Regulated by Accessory Proteins Csx27 and Csx28. Smargon AA, Cox DB, Pyzocha NK, Zheng K, Slaymaker IM, Gootenberg JS, Abudayyeh OA, Essletzbichler P, Shmakov S, Makarova KS, Koonin EV, Zhang F. Mol Cell. 2017 Feb 16;65(4):618-630.e7. doi: 10.1016/j.molcel.2016.12.023. Epub 2017 Jan 5. 10.1016/j.molcel.2016.12.023 PubMed 28065598