NGN3-T2A-NLS-tdTomato-ires-puro-BGHpA-PGK-puro
(Plasmid
#89994)
-
PurposeDonor template for generation of NGN3-ntdTomato reporter cell lines
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89994 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 9769
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNGN3-T2A-NLS-TdTomato-ires-puro-BGHpA-PGK-puro
-
SpeciesH. sapiens (human)
-
Entrez GeneNEUROG3 (a.k.a. Atoh5, Math4B, NGN-3, bHLHa7, ngn3)
- Promoter none
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer M13-rv caggaaacagctatgaccatg
- 3′ sequencing primer M13-fwd tgtaaaacgacggccagt
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made bytdTomato sequence was cloned from pCSCMV:tdTomato (a gift from Gerhart Ryffel, Addgene plasmid #30530)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NGN3-T2A-NLS-tdTomato-ires-puro-BGHpA-PGK-puro was a gift from Timo Otonkoski (Addgene plasmid # 89994 ; http://n2t.net/addgene:89994 ; RRID:Addgene_89994)