-
PurposeThis plasmid contains destabilized Cas9 and has Venus after P2A sequence. This vector also contains filler sequence which required to be removed for cloning of desired sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 90085 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerAddgene
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9
-
SpeciesSynthetic
-
GenBank ID301447
- Promoter EFS
-
Tags
/ Fusion Proteins
- Destabilized Domain (N terminal on insert)
- Flag (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ATTATCTAGAGCCACCATGGGAGTGCAGGTGGAAACCATCTCCCCAGGTGACG GGCGCACCTTCCCCAAGCGCG
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DD-Cas9 with filler sequence and Venus (EDCPV) was a gift from Raffaella Sordella (Addgene plasmid # 90085 ; http://n2t.net/addgene:90085 ; RRID:Addgene_90085) -
For your References section:
Rapid and tunable method to temporally control gene editing based on conditional Cas9 stabilization. Senturk S, Shirole NH, Nowak DG, Corbo V, Pal D, Vaughan A, Tuveson DA, Trotman LC, Kinney JB, Sordella R. Nat Commun. 2017 Feb 22;8:14370. doi: 10.1038/ncomms14370. 10.1038/ncomms14370 PubMed 28224990