LP377
(Plasmid
#90201)
-
PurposepCMV-myc with cDNA encoding HsTRAPPC11 aa residues 701-1133
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90201 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMV-Myc
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 5096
-
Modifications to backboneNone
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTRAPPC11
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1296
-
Mutationaa residues 701-1133
-
GenBank IDNP_068761.4
-
Entrez GeneTRAPPC11 (a.k.a. C4orf41, FOIGR, GRY, LGMD2S, LGMDR18)
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CMV-F: CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer SV40pA-R: GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LP377 was a gift from Lotte Pedersen (Addgene plasmid # 90201 ; http://n2t.net/addgene:90201 ; RRID:Addgene_90201) -
For your References section:
Identification of conserved, centrosome-targeting ASH domains in TRAPPII complex subunits and TRAPPC8. Schou KB, Morthorst SK, Christensen ST, Pedersen LB. Cilia. 2014 Jun 18;3:6. doi: 10.1186/2046-2530-3-6. eCollection 2014. 2046-2530-3-6 [pii] PubMed 25018876