LP539
(Plasmid
#90203)
-
PurposepCMV-myc with cDNA encoding HsTRAPPC8 aa residues 1-700
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 90203 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV-Myc
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 5900
-
Modifications to backboneNone
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTRAPPC8
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2100
-
Mutationaa residues 1-700
-
GenBank IDNP_055754.2
-
Entrez GeneTRAPPC8 (a.k.a. GSG1, HsT2706, KIAA1012, TRS85)
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CMV-F: CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer M13 Reverse: CAGGAAACAGCTATGAC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Figures in Verdier et al. 2016 might suggest Myc tag is at the C-terminus, but the cloning vector is pCMV-Myc and the Myc tag is placed on N-terminus of protein.
Addgene's sequencing results found an S697D mutation in TRAPPC8 compared to the reference sequence NP_055754.2. This mutation is not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LP539 was a gift from Lotte Pedersen (Addgene plasmid # 90203 ; http://n2t.net/addgene:90203 ; RRID:Addgene_90203) -
For your References section:
Targeting of ASH Domain-Containing Proteins to the Centrosome. Verdier P, Morthorst SK, Pedersen LB. Methods Mol Biol. 2016;1454:15-33. doi: 10.1007/978-1-4939-3789-9_2. 10.1007/978-1-4939-3789-9_2 PubMed 27514913