LP555
(Plasmid
#90204)
-
PurposepCMV-myc cDNA encoding HsTRAPPC8 aa residues 701-1436
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90204 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMV-Myc
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3800
- Total vector size (bp) 6005
-
Modifications to backboneNone
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTRAPPC8
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2205
-
Mutationaa residues 701-1436
-
GenBank IDBAG10409.1
-
Entrez GeneTRAPPC8 (a.k.a. GSG1, HsT2706, KIAA1012, TRS85)
- Promoter CMV
-
Tag
/ Fusion Protein
- Myc (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CMV-F: CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer M13 Reverse: CAGGAAACAGCTATGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Figures in Verdier et al. 2016 might suggest Myc tag is at the C-terminus, but the cloning vector is pCMV-Myc and the Myc tag is placed on N-terminus of protein
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LP555 was a gift from Lotte Pedersen (Addgene plasmid # 90204 ; http://n2t.net/addgene:90204 ; RRID:Addgene_90204) -
For your References section:
Targeting of ASH Domain-Containing Proteins to the Centrosome. Verdier P, Morthorst SK, Pedersen LB. Methods Mol Biol. 2016;1454:15-33. doi: 10.1007/978-1-4939-3789-9_2. 10.1007/978-1-4939-3789-9_2 PubMed 27514913